Concept de transmission par voie aérienne.La transmission du virus Ebola chez les porcs à des primates non humains

Publié le par MrStrange49

source : http://www.nature.com/srep/2012/121115/srep00811/full/srep00811.html

traduction automatique

Rapports scientifiques 2, Numéro d'article : 811 doi: 10.1038 / srep00811

Reçu
Accepté
Publié

Virus d'Ebola (EBOV) causent la fièvre hémorragique souvent mortelle chez plusieurs espèces de primates simiens y compris l'homme. Alors que les roussettes sont considérés comme le réservoir naturel, la participation d'autres espèces dans la transmission EBOV n'est pas claire. En 2009, Reston-EBOV a été le premier EBOV détecté chez le porc avec la transmission indiquée pour les humains. Transmission du Zaïre-EBOV (ZEBOV) entre les porcs en contact a été démontrée expérimentalement. Ici, nous montrons transmission ZEBOV de porcs à des macaques de Buffon sans contact direct. Fait intéressant, la transmission entre les macaques dans des conditions de logement semblables n'a jamais été observée. Porcelets inoculés oro-nasale avec l'espèce Zaïre ont été transférés aux macaques de logement de chambre dans un système ouvert de la cage inaccessible. Tous les macaques ont été infectées. Le virus infectieux a été détecté dans les prélèvements oro-nasales des porcelets, et dans le sang, les tampons, et des tissus de macaques. C'est le premier rapport de transmission du virus expérimental inter-espèces, avec les macaques également utilisés comme substitut humain. Notre conclusion peut influencer les mesures de prévention et de contrôle au cours des flambées EBOV.

En bref

Introduction

Virus Ebola appartient à la famille des Filoviridae, genre Ebola. Ceux endémique à l'Afrique causer de la fièvre hémorragique sévère avec issue fatale fréquente chez les humains, les grands singes et de plusieurs espèces de primates non humains (PNH). Les roussettes sont considérés comme le réservoir naturel pour EBOV en Afrique 1 . En 2009, les seules espèces connues non-africains de EBOV, le virus Ebola Reston (Rebov), a été isolé chez des porcs aux Philippines, avec des anticorps contre le virus détecté dans les éleveurs de porcs 2 , 3 . Cependant Rebov n'a pas causé de signes cliniques chez les porcs inoculés expérimentalement 4 . Contrairement aux espèces africaines de EBOV, Rebov ne provoque pas de symptômes cliniques chez les humains, bien que l'infection peut être mortelle chez les macaques de Buffon 5 . Nous avons déjà démontré que le Zaïre-EBOV (ZEBOV) peut infecter les porcs, causer des maladies, et de transmettre à des porcs en contact 6 . Tandis que des primates à développer une infection systémique associée à une dysrégulation immunitaire résultant de la fièvre hémorragique grave, l'infection chez le porc EBOV affecte principalement les voies respiratoires, impliquant un potentiel de transmission par voie aérienne de l'espèce Zaïre 2 , 6 . Contactez exposition est considérée comme la plus importante voie d'infection par EBOV chez les primates 7 , bien qu'il existe des rapports suggérant ou suspectant la transmission par aérosol de EBOV de PSN PSN 8 , 9 , 10 , ou chez l'homme fondées sur des observations épidémiologiques 11 . La présente étude était d'évaluer la conception transmission de EBOV de porcelets infectés expérimentalement à des PSN sans contact direct.

Résultats

Six anciens de quatre semaines porcelets Landrace (Sus scrofa) ont été inoculés avec oronasale 10 6 DICT 50 de l'espèce Zaïre (Kikwit 95) par animal. Les porcelets ont été transférés dans une salle séparée pour les inoculations, puis sont retournés dans la salle contenant quatre macaques de Buffon. Ce groupe d'âge a été sélectionnée sur la base de l'observation précédente de différences dans la sévérité de la maladie dans l'espèce Zaïre inoculé porcelets 6 pour assurer un temps de survie suffisant des porcelets potentiellement nécessaires à la transmission du virus, et pour déterminer si les porcelets sans signes cliniques évidents, pourraient transmettre le virus . Les macaques ont été logés dans des cages à deux niveaux différents à l'intérieur de la porcherie, et séparés des porcelets par le pare-fils placés à environ 20 cm devant les cages de fond pour empêcher tout contact direct entre les deux espèces. Cages boîtier inférieur PSN nos. 07M et 20F étaient environ 10 cm au-dessus du sol, top cages abritant PSN nos. 34F et 51M étaient environ 1,4 m au-dessus du sol. Les cages étaient situés immédiatement PSN sur le côté du système d'échappement d'air. La disposition de la cellule respective à l'écoulement d'air (dix changements d'air par heure complète) de la pièce est indiqué schématiquement dans la figure S1 supplémentaire . Au cours de l'élevage, les porcelets ont été déplacés loin des cages et enfermés par le système de grille. Le sol a été lavé, en prenant soin que l'eau est pulvérisée à basse pression et loin des cages PSN, pour éviter les éclaboussures dans les cages de fond. Aussi l'espace de 20 cm entre la barrière de fil et les cages a été nettoyée séparément à l'eau courante avant de procéder à PSN nettoyage de la cage. Les deux espèces animales ont été nourris après le nettoyage, la fourniture de nouveaux plats propres pour les macaques, avec le personnel de changer de gants jetables extérieures entre les procédures et les animaux. La conception et la taille de la cellule animale ne permettent pas de distinguer si la transmission a par aérosols, petites ou grandes gouttelettes dans l'air, ou des gouttelettes créées pendant le nettoyage des sols qui a atterri à l'intérieur des cages PSN (de vecteurs passifs). Le débit de l'élevage pendant les jours d'échantillonnage était: nettoyage, suivi par échantillonnage, puis l'alimentation, avec le personnel changer de gants jetables extérieures entre les procédures et les animaux. Les porcs et les produits de santé naturels ont été échantillonnés sur les deux jours, sauf pour infection post jour 3, lorsque les PSN ont été échantillonnés dans la matinée et les porcelets dans l'après-midi.

Les signes cliniques et la pathologie chez le porc, après l'inoculation avec EBOV, étaient comparables à l'étude de l'infection précédente chez les porcelets de ce groupe d'âge 6 . Augmentation de la fréquence respiratoire (jusqu'à 80 cycles / min) et à des températures rectales (40,2 à 40,5 ° C) a été observée entre l'infection post 5 et 7 jours (dpi). Tous les porcelets apparemment récupéré de la maladie par 9 dpi. Porcelets n °. 1, 2 et 4 ont été euthanasiés à 12 dpi, et les porcelets n °. 3, 5 et 6 à 14 dpi, basé sur protocole expérimental. Scores et les paramètres cliniques sont fournies dans la Information supplémentaire ( Supplemental Figure 2A, tableau supplémentaire 1 ). Pas de lésions significatives ont été observées à l'autopsie. Lésions pulmonaires microscopiques étaient focal et non extensive, caractérisée par une pneumonie broncho-interstitielle avec un aspect lobulaire, similaires à celles décrites dans notre rapport précédent 6 . un antigène du virus a été détectée par immunohistochimie dans trois porcelets (n ° 2, 4, et le signal de la semaine n ° 5), principalement dans les zones de nécrose souvent adjacente à bronchioles ( figure supplémentaire S3A ). La présence de virus dans le poumon a été confirmée par détection de l'ARN EBOV en temps réel en utilisant la RT-PCR ciblant le gène de L, et par isolement du virus sur les cellules Vero E6 pour porcelet n ° 2 et n ° 4 L'isolement du virus a également été tentée de poumon associé ganglions lymphatiques, basé sur la détection de l'ARN viral, ce qui donne un isolement réussi. L'ARN viral a été détectée dans les ganglions lymphatiques sous-maxillaires de tous les porcelets, et dans la rate et le foie de deux porcelets. Faible niveau de la virémie en fonction des niveaux d'ARN a été détecté dans le sang de quatre porcelets à 5 et 7 dpi. EBOV ARN a été détecté dans des prélèvements nasaux et oraux de porcelets de 1 ppp jusqu'à 7 dpi, inclusivement ( figure 1A ), et à partir de prélèvements rectaux le jour 1 et 5, mais pas à 3, 7 et 12 dpi ( tableau supplémentaire 1 ). L'isolement viral a été tentée sur tous les écouvillons. Sur les 45 prélèvements orale et nasale positifs par RT-PCR, 16 étaient positifs sur l'isolement du virus, tandis que deux des 11 prélèvements rectaux ARN positif ont été testés positifs pour le virus. La présence de l'ARN EBOV dans les surnageants de culture de cellules à partir des isolats avec CPE observé a été confirmée par temps réel RT-PCR ( tableau 1 supplémentaire; complémentaires Tableau 2 ).

Figure 1: détection de l'ARN à partir d'écouvillons EBOV et le sang.
Détection de EBOV ARN à partir d'écouvillons et le sang.

(A) chez les porcs. Carrés représentent les écouvillons oraux et les triangles représentent des écouvillons nasaux. Ligne grise avec des diamants montre la tendance générale de l'effusion de oro-nasale. (B) des primates non-humains: des marqueurs carrés représentent les prélèvements oraux, les diamants représentent les prélèvements rectaux, triangles représentent les écouvillons nasaux, cercles représentent des échantillons de sang. Marqueurs-PSN gris n ° 51M et 20F, marqueurs-PSN noir 07M et 34F. "Dpi" (jours après l'inoculation) et "dpe" (jours après l'exposition) sur l'axe des X sont équivalentes.

échantillonnage de l'air a été effectuée au jour 0, 3, 6, 8 et 11 après l'inoculation. En temps réel RT-PCR ciblant le gène L détecté l'ARN viral aux jours 6 et 8 après l'inoculation. Lieu devant les cages de fond à environ 75 cm du sol a été échantillonné en 30 min en triple suivantes élevage, lors de l'échantillonnage PSN. Les valeurs moyennes de 4,4 log 10 copies / ml et 3,85 log 10 copies / ml du tampon d'échantillonnage ont été détectés à 6 et 8 dpi, respectivement. isolements de virus ont échoué, probablement en raison de la composition du tampon d'échantillonnage (0,1% de Tween 20).

Tous les quatre PSN (Macaca fascularis) étaient alertes et en bonne santé apparente jusqu'à 7 jours après l'exposition (dpe - correspondant à des porcelets dpi) avec l'espèce Zaïre. A 8 dpe, macaques 07M (cage en bas à gauche) et 34F (cage en haut à droite), logés dans des cages situées dans un flux d'air vers le système d'échappement, ont été euthanasiés après les signes cliniques typiques de l'infection EBOV dans les PSN. Les deux avaient des hémorragies pétéchies sur la peau de la poitrine et le long des surfaces internes des bras et des jambes. Macaques 51M et 20F étaient visuellement santé jusqu'à 12 dpe, lorsque les signes cliniques ont été observés au début, et les deux animaux ont été euthanasiés le lendemain (13 dpe). Le PSN ont été euthanasiés lorsque les signes cliniques convaincants typiques de l'infection EBOV sont apparues, de préférence avant le critère humain ( Figure supplémentaire S2B; supplémentaire Tableau 1 ). Examen des organes internes aux dommages de l'autopsie exposée principalement dans les poumons ( supplémentaire Figure S4 ) et le foie. Les lésions microscopiques et la distribution de l'antigène dans les organes étaient semblables à des rapports précédents 12 , 13 , 14 , à l'exception des lésions et de la distribution de l'antigène dans les poumons. Pneumonie interstitielle a été caractérisée par un épaississement du septum et hypercellulaire alvéolaire due à l'infiltration par les macrophages (principalement supplémentaire Fig. 3B ), avec des zones multifocales d'hémorragie alvéolaire et de l'œdème. EBOV antigène a été détectée en détail dans les macrophages alvéolaires et du septum à l'aide de deux immunomarquage ( Supplemental Fig. 3C ), ainsi que dans les pneumocytes et les cellules endothéliales. L'antigène viral a également été observée dans les cellules epitheliales bronchiolaires avec une perte de segment adjacent de cellules epitheliales ( Figure 2 .) et dans les cellules épithéliales de la trachée respiratoire. Le motif de lésions et coloration immunologique de l'antigène dans les poumons EBOV suggère infection des poumons la fois, par l'intermédiaire de l'épithélium respiratoire et en raison de la propagation du virus de la virémie.

Figure 2: poumons, le macaque No.34F.
Poumons, No.34F macaque.

Atténuation segmentaire et la perte de l'épithélium respiratoire dans la paroi des bronchioles (grande flèche) avec quelques zones des poumons assez peu touchés (pointe de flèche). L'immunocoloration pour l'antigène du virus Ebola a été détecté dans les cellules épithéliales des voies respiratoires occasionnels (petite flèche), ainsi que l'intérieur du septum alvéolaire et les macrophages. Bar = 50 μ m.

Il y avait une différence notable dans le type et la quantité de cellules infiltrant les poumons entre les macaques et les porcs, bien que l'antigène viral a été détecté uniquement dans les macrophages alvéolaires des deux espèces. Les monocytes / macrophages sont essentiellement le seul type de leucocytes infiltrant les poumons chez les primates non humains, tandis que de grandes quantités de lymphocytes non infectés ont été recrutés dans les poumons de porcs. Ce phénomène peut être lié à différents tableau clinique dans les deux espèces animales: détresse respiratoire chez les porcs (sévère dans un groupe d'âge spécifique 6 ) par rapport à une maladie systémique sans signes respiratoires majeurs dans les PSN. Il sera important d'identifier les différences et les similitudes dans la pathogenèse et la pathologie ZEBOV induite entre les deux espèces dans les études futures.

Infection de la PSN avec ZEBOV a été confirmée par détection de l'ARN viral (temps réel RT-PCR ciblant le gène L), et dans tous les échantillons recueillis à l'euthanasie par isolement du virus. La première détection de l'espèce Zaïre ARN était dans le sang des PSN 34F et 07M à 6 dpe, l'isolement du virus de macaque 07M. Ceci a été suivi par la détection de l'ARN dans l'espèce Zaïre nasale, orale et rectale tampons de la même PSN à 8 DPE ( Figure 1B ). Une tendance similaire a été observée pour les macaques 51M et 20F, à partir de 11 dpe avec détection de l'ARN dans le sang et l'isolement du virus de l'animal 20F, suivie de la détection de l'ARN et virus dans les prélèvements à 13 dpi. La détection de l'ARN viral et le virus infectieux dans le sang, les écouvillons et les tissus de macaques (résumé dans le tableau 4 complémentaire ) a confirmé la propagation systémique du virus. Séquençage complet du génome effectué sur l'acide nucléique du virus à partir d'échantillons de frottis et du poumon sélectionnés à partir de porcs et les PSN a confirmé l'identité du virus.

Discussion

Les porcs ont été la source de l'espèce Zaïre à un moment de l'infection des PSN euthanasiés à 8 dpe (07M et 34F) depuis l'excrétion des macaques n'a pas été détectée au dpe 3 ou 6. PSN euthanasiés à 13 dpe (20F, 51M) aurait contracté ZEBOV à partir de l'environnement contaminé par ces deux espèces, en considérant les rapports précédents sur le développement de la maladie après une exposition d'aérosol 10 ou d'autres voies d'inoculation 5 , 15 , 16 , bien que les porcs peuvent générer infectieuses courte portée de grosses gouttelettes d'aérosol de manière plus efficace, puis d'autres espèces 17 . Nous avons également jamais observé transmission de EBOV des personnes infectées aux macaques naïfs, y compris dans une expérience utilisant le même réglage de la cage comme dans l'étude actuelle, où trois PSN intramusculaire inoculés avec EBOV ne transmettent pas le virus à un naïf PSN pendant 28 jours, le durée du protocole. Lors d'une autre étude, trois EBOV infecté PSN cohabitant avec 10 naïve PSN en cages adjacentes ne pas transmettre le virus à des animaux naïfs pour 28 jours (données non publiées). L'itinéraire exact de l'infection du PSN est impossible de discerner avec certitude parce qu'ils ont été euthanasiés à un moment où EBOV s'était déjà propagé systémique. Cependant, l'atténuation segmentaire et la perte de l'épithélium bronchiolaire et la présence de l'antigène du virus Ebola dans certaines des cellules epitheliales des voies respiratoires dans les poumons de tous les macaques suggèrent que les voies respiratoires sont l'une des voies impliqués dans l'acquisition d'une infection, en accord avec les rapports précédents 9 , 10 . D'autres voies d'inoculation n'ont généralement pas conduit à des lésions des voies respiratoires comparables à ceux observés dans cette étude 12 , 13 .

Dans les conditions de la présente étude, la transmission de l'espèce Zaïre aurait pu se produire soit par inhalation (aérosol ou de gouttelettes plus grosses), et / ou de gouttelettes inoculation des yeux et des surfaces muqueuses et / ou par des matières contaminées en raison de gouttelettes générés au cours du nettoyage de la chambre. Infection des quatre macaques dans un environnement empêchant tout contact direct entre les deux espèces et entre les macaques eux-mêmes, soutient le concept de transmission par voie aérienne.

Il est intéressant que les premiers macaques d'être infectées ont été logés dans des cages situées directement à l'intérieur de l'écoulement d'air principal dans le système d'échappement d'air. Le cadre expérimental de la présente étude n'a pas pu quantifier la contribution relative des aérosols, petites et grandes gouttelettes dans l'air, et les gouttelettes d'atterrissage à l'intérieur des cages PSN (de vecteurs passifs) à transmission EBOV entre les porcs et les macaques. Ces paramètres devront être étudiée en utilisant une approche expérimentale spécifiquement conçu pour répondre à cette question.

La présente étude fournit des preuves que des porcs infectés peuvent transmettre efficacement ZEBOV aux PSN dans des conditions s'apparentant cadre agricole. Nos résultats soutiennent l'hypothèse que la transmission aérienne peut contribuer à ZEBOV propagation, en particulier de porcs à des primates, et peut-être besoin d'être pris en compte dans l'évaluation de la transmission des animaux aux humains en général. Les présents résultats expérimentaux expliqueraient Rebov séropositivité des éleveurs de porcs aux Philippines 2 , 3 qui n'ont pas été impliqués dans l'abattage ou eu aucun contact connu avec des tissus de porcs contaminés. Les résultats de cette étude soulèvent également la possibilité que les porcs sauvages ou domestiques peut être un naturel (non-réservoir) hôte pour EBOV participer à la transmission de EBOV à d'autres espèces en Afrique subsaharienne.

Méthodes

Virus

Souche ZEBOV Kikwit 95 a été produite sur des cellules Vero E6 dans un milieu essentiel minimal (MEM) additionné de 2% de sérum et d'antibiotiques (pénicilline / streptomycine) bovin foetal. Les titres de virus ont été déterminés par la norme DICT 50 et / ou des essais immunoplaque sur des cellules Vero E6. Procédures pour la production et la propagation de l'espèce Zaïre et toutes les expériences ultérieures impliquant des matières infectieuses ont été effectuées dans le niveau de confinement (CL) 4 installations du Centre scientifique canadien de santé humaine et animale (CSCSHA).

L'expérimentation animale

Quatre macaques cynomolgus ont été acclimatés dans l'établissement BSL4 animal pendant deux semaines, et logés dans la même chambre pendant une semaine avant l'inoculation porcine. Les macaques ont été logés dans des cages à deux niveaux différents à l'intérieur de la porcherie, et séparés des porcelets par le pare-fils placés à environ 15 cm en avant de la cage pour empêcher le contact direct entre les deux espèces. Cages boîtier inférieur PSN nos. 07M et 20F étaient environ 20 cm au-dessus du sol, tout en haut des cages abritant PSN nos. 34F et 51M étaient environ 1,4 m au-dessus du sol. Le PSN ont été échantillonnées à 3 et 6 dpi (nasale, prélèvements rectaux orales, sang), selon le calendrier expérimental. Deux macaques ont été euthanasiés pour des raisons humanitaires à 8 jours après l'exposition (dpe), et tous les animaux ont été prélevés à ce moment-là. Deux PSN restants étaient en plus échantillonné à 11 dpe, et AT13 dpe quand ils ont été euthanasiés. Les animaux ont été euthanasiés lorsque les signes cliniques typiques de l'infection à virus Ebola est devenu évident, si possible avant d'atteindre le critère d'évaluation humaine. Du poumon, les ganglions lymphatiques pulmonaires associés, le foie, la rate et l'intestin ont été prélevés à l'autopsie.

Porcs (race Landrace) ont été obtenus à partir d'un état troupeau élevé pour la santé exploité par un fournisseur commercial reconnu au Manitoba, Canada. Trois semaines porcelets, désignés comme animaux n ° 1-6, ont été acclimatés pendant sept jours avant l'inoculation dans une armoire animale abritant déjà les primates non humains. Les six porcelets ont été inoculées oro-nasale avec 2 ml de 10 6 TCID 50 totale par animal (0,5 ml par narine et chaque 1 ml par voie orale) dans une chambre adjacente à la cellule animale BSL4 et ensuite logé à proximité de cages à quatre non primates non humains (PNH). Les températures rectales ont été prises porcs lors de l'échantillonnage effectué sous anesthésie aux jours 0, 1, 3, 5, 7, 12 et 14, lorsque le sang et par voie rectale, par voie orale et les écouvillons nasaux ont été prélevés. Trois porcelets ont été euthanasiés au jour 12 après l'inoculation (pas. 1M, 2M. 4F), et trois au jour 14 (3M, 5F, 6F), selon le calendrier expérimental. Muscle, du poumon, du foie, de la rate, de la trachée, et sous-maxillaire, du poumon associés et les ganglions lymphatiques mésentériques ont été recueillies lors de l'autopsie.

Toutes les manipulations d'animaux ont été effectuées dans des conditions de CL4 et suivre l'utilisation des animaux Document No. CSCSHA AUD # C-11-004 approuvé par le Comité du Centre scientifique canadien de santé humaine et animale protection des animaux, selon et en suivant les lignes directrices du Conseil canadien de protection des animaux.

L'isolement du virus

Les écouvillons collectés dans 1 ml de CMEM, le sang et les tissus homogénéisés dans du MEM en utilisant un homogénéisateur de broyeur à billes selon le protocole du fabricant (Tissue Lyser, Qiagen) ont été utilisés pour l'isolement du virus et l'analyse en temps réel RT-PCR. Tous les échantillons PSN et prélèvements rectaux porcine ont été étalées dans 10 dilutions de surnageant sur des cellules Vero E6 avec six répétitions par dilution. À 72-96 h post-infection, les plaques ont été marqués pour effet cytopathogène (ECP) et DICT 50 titres de virus ont été calculées en utilisant la méthode de Reed et Muench. Rectaux porcs ont dû être toutefois reporté sur plaques de réplique pour trois passages avant de lire le CPE. Swine nasale et orale tampons, le sang et les tissus ont été analysés par premier temps réel RT-PCR ciblant le gène L ZEBOV, suivie par l'isolement du virus sur les cellules Vero E6 dans des plaques P6 sur les échantillons sélectionnés.

détection de l'ARN du virus de

Échantillons PSN: L'ARN total a été isolé à partir de tissus conservés et homogénéisés dans de l'ARN par la suite en utilisant le kit RNeasy Mini (Qiagen). ARN de lavages nasaux et des tampons a été isolé en utilisant le kit QIAamp Viral RNA Mini (QIAGEN, GmbH).

Échantillons de porcs: L'ARN a été isolé en utilisant Tripure réactif (Roche Applied Science) selon les recommandations du fabricant de tampons, de sang ou de 10% p / homogénats de tissus de v dans CMEM. One-Step en temps réel RT-PCR a été réalisée en utilisant les amorces et la sonde suivantes:

ZebovForward -CAGCCAGCAATTTCTTCCAT;

ZebovReverse- TTTCGGTTGCTGTTTCTGTG;

ZebovProbe FAM-ATCATTGGCGTACTGGAGGAGCAG-NFQ.

ARN des entérovirus blindée (Asuragen) a été utilisé comme contrôle extraction / réaction externe. Kit de PCR en temps réel Quantitect Reverse Transcriptase (Qiagen) a été utilisé pour les réactions de PCR selon les spécifications du fabricant. Les conditions réactionnelles pour la RT-PCR étaient les suivantes: 50 ° C pendant 30 minutes; 95 ° C pendant 15 minutes; 45 cycles de 95 ° C pendant 15 secondes suivis par 60 ° C pendant 45 secondes. Les échantillons ont été passés sur le Rotor-Gene 6000 (Qiagen) ou sur le LightCycler 480 (Roche Applied Science). nombre de copies ont été déterminés sur la base du L-gène Ebola plasmide de la courbe de contrôle standard. Valeur limite pour les échantillons à être considéré comme positif était de 3 log 10 copies / ml (RotorGene) ou 3,15 log 10 copies / ml (LightCycler 480).

Échantillonnage de l'air

L'air a été échantillonné en utilisant BioCapture 650 Air Sampler (FLIR, Arlington, VA) aux jours 0, 3, 6, 8 et 11 après l'inoculation des porcelets. L'échantillonnage de l'air a commencé après l'élevage, concurrente de PSN échantillonnage, plus tard dans la matinée avant midi. Lieu devant les cages de fond à environ 75 cm du sol a été échantillonné en 30 min triple. La collection a eu lieu sur une période d'environ deux heures au total (trois fois de collecte de 30 min avec des changements de cartouches entre les deux). Le dispositif de prélèvement d'air par barbotage recueille les particules de l'air à travers un tampon de pré-charge (Tris 0,74% / Tween 20 à 0,1) prévu dans une cartouche scellée par le fabricant. Cette solution n'est pas optimale pour la récupération des virus enveloppés vivants, et les tentatives d'isolement du virus ont été infructueuses. ZEBOV ARN a été détectée en temps réel RT-PCR ciblant le gène de L.

Séquençage EBOV

L'ARN viral extrait précédemment pour la PCR en temps réel a été séquencé par l'ADNc du premier générateur à l'aide d'Omniscript transcriptase (Qiagen) inverser et des hexamères aléatoires ainsi que les amorces d'EBOV spécifiques suivies par PCR avec iProof haute fidélité de l'ADN polymerase (Bio-Rad) avec des amorces spécifiques ( disponible sur demande). Le séquençage d'ADN a été réalisée en utilisant le 3730xl DNA Analyzer (ABI).

Histologie et immunohistochimie

Les tissus ont été fixés dans 10% de phosphate du formol tamponné neutre, inclus dans la paraffine en utilisant des procédures standards, sectionnés à 5 m, et colorées à l'hématoxyline et à l'éosine (HE) pour un examen histopathologique. La détection de l'antigène viral a été effectuée en utilisant une dilution au 1: 2000 d'anticorps polyclonal de lapin anti-VP40 ZEBOV comme décrit précédemment 6 . Identification des macrophages dans les poumons a été réalisée par immunomarquage pour la L1 marqueur des macrophages / monocytes en utilisant Clone Mac387 (Dako, USA) anticorps primaires. Les coupes de tissus ont été trempées pendant 10 minutes dans une solution aqueuse à 3% de peroxyde d'hydrogène, préalablement à la récupération des épitopes en utilisant un pH élevé AR10 (BioGenex, CA) dans une chambre BioCare Decloaking médicale. Anticorps Clone Mac 387 a été appliqué pendant 10 minutes à une dilution de 1: 3200, et visualisées en utilisant un kit AP-polymère, Mach 4 Universal (BioCare médicale, CA) pendant 30 minutes, et réagit avec Vulcan Fast Red (BioCare médicale, CA ) substrat. Pour la double tache Mac387 / Ebola, anticorps Clone Mac 387 a été appliqué pendant 10 minutes à une dilution de 1: 3200, et visualisées en utilisant un raifort multibras marqué à la peroxydase de kit, système de détection IHC (BioGenex, CA) Super Sensitive Lien label, réagi avec le chromogène diaminobenzidine (DAB). Les sections ont ensuite été incubées avec une solution de dénaturation (1 partie A, 3 parties B, BioCare médicaux, CA) pendant 5 minutes, préalablement traités avec de la protéinase K enzyme pendant 10 minutes, et rabit anticorps polyclonal anti-virus Ebola Zaïre VP40 a été appliquée sur les sections à une dilution de 1: 2000 pendant une heure. L'anticorps anti-EBOV a été visualisée en utilisant un kit AP-polymère, Mach 4 universel (BioCare médical, CA) pendant 30 minutes et mis à réagir avec le substrat Vulcan Fast Red (BioCare médical, CA). Toutes les sections sont contre-colorées avec l'hématoxyline de Gill.

Publié dans Santé

Pour être informé des derniers articles, inscrivez vous :